Production of Recombinant Proteins Gst L1, E6 and E7 Tag Hpv 16 to be Used in Luminex Assay for Antibody Detection Among Tunisian Female Population Wi

by Rachel on May 9, 2010

Production of recombinant GST proteins L1, E6 and E7 of HPV type 16 tag used in the Luminex test to detect antibodies in the Tunisian female population with cervical cancer and controls Achour. M * A, Ben Younes. Ra, Kahla. Sam Kochbati. Lb, Zeghal. Dc Maalej. MB, Zouari. Fc Oueslati. Ra a microbiology laboratory of the Environmental and Immuno-carcinogenesis (IMEC Unit) Faculty of Sciences of Bizerte, Tunisia Zarzouna 7021. B Department of Radiotherapy Cancer Institute Tunisia Azeiz Salah. Department of Obstetrics and Gynecology c Center for Maternal and Neonatal Hospital La Rabta Tunisia. * Corresponding author Achour Mongia E-mail: mahaachour2000 @ yahoo. Fri Tel: 216 72591845 Fax: 216 72590566 SUMMARY: Some types of human papillomavirus (HPV), especially HPV types 16 and 18 were identified as important etiological factors for the development of cancer of the cervix. antibodies against HPV antigens is associated with the development of cancer of the cervix uteri in the frame. Various tests can be used to detect antibodies, but they have low sensitivity and specificity. In this study we focus on the preparation of recombinant proteins for use as the Luminex technology to be subjected to serological tests in the Tunisian population of women. Thus, HPV 16 L1, E6 and E7 sequences in their 3 ‘ends with a sequence as the terminal undecapeptide of the SV40 large T antigen (Tag merged) were isolated from plasmids and expression vector pGEX as GST fusion protein in the proteins of E. coli. Coding sequences for L1tag, E6tag E7tag and HPV 16 or have been mobilized by digestion with enzymes and ligated into the digested plasmid behind the area of GST. An expression plasmid of GST-tag was constructed by inserting a fragment encoding the epitope. Cells of E. coli BL 21 was transformed with pGEX plasmids and grown in Luria Bertani medium with ampicillin. Expression of recombinant protein was induced by the addition of 0. 25 mM isopropyl-?-D-thio-galactoside (IPTG) in the middle. The bacteria were harvested after induction and bacteria embedded in a phosphate buffered saline (PBS resuspended) and lysed with a high pressure homogenizer. Lysates were then clarified by centrifugation. The proteins were verified by migration in sodium dodecyl sulfate (SDS) gel electrophoresis. The data showed that they had been stable for the proof and the lysates were stored at -20 ° C to be used in Luminex for the detection of antibodies in the Tunisian population of women. This test showed that the sero-positivity is different against different antigens on the study group and differences between cases and controls were significant (P Keywords: GST-Tag – E coli – HPV 16 – L1 – E6 – E7 – Luminex INTRODUCTION: At the global level, is the human papillomavirus (HPV), the half-million cases and 270,000 deaths from cancer of the cervix, which is responsible for more than two. 5000000 years of life lost (YLL) per year (Sue et al., 2007). HPV type 16 (and to a lesser degree HPV type 18) with rare cancers, namely cancer of the vulva, vagina, penis, anus, oropharynx and larynx. Effective prophylactic vaccines have been developed (Dillner et al., 2007). Molecular epidemiological studies have shown that specific subtypes of HPV and cervical cancer (Castle and Giuliano, awarded 2003; Dillner and Brown, 2004). The HPV group now consists of more than 100 species fully characterized. partial sequences of more isolates showed that there are at least 100 other HPV. Of the 15 genital HPV oncogenes are found in humans. HPV type 16 virus is by far the largest, over 50% of all cases of cancer of the cervix. HPV16 even more dominant as the etiology of cancers associated with HPV noncervical (Dillner, 2005). HPV serology is complex for several reasons. Different types of HPV can infect the epithelium of the skin or mucous membranes and cause proliferative diseases. antibodies against HPV type specific. The fight against the major viral capsid protein L1 are markers of infection, and those for the viral oncoproteins E6 and E7 are markers for HPV-associated cancers (Waterboer et al., 2005). Traditional methods such as ELISA serological analysis of sera antibodies to allow a single antigen per well. Previous studies have determined using antibodies against early antigens E6 proteins by ELISA than smaller ones, the linear epitopes of protein, but sometimes they have low sensitivity and specificity. To improve the method have other immunological approaches, such as radioimmunoprecipitation assay (RIPA) with all the native proteins and sandwich ELISA with long-term (before Meschede and put al., 1998). Today, HPV serology is usually practiced in a limited number of laboratories, but it is likely to be widely used in clinical laboratories in the serum after vaccination against HPV. Previous studies have shown that the method Luminex represents an attractive method for HPV serology in laboratories with high throughput (Waterboer et al., 2006). In this report, the viral antigens with pGEX vectors in Escherichia coli as fusion proteins with GST-double N-terminal and C-terminal peptide (TAG), consisting of 11 C-terminal amino acids of the antigen large T, the 40th simian virus expressed levels of protein lysates were cleared, as determined using the Bradford reagent and was considered to characterize the full length recombinant protein by Coomassie stained SDS-PAGE. In addition, the titration of antigen lysates was done using mouse anti-tag. These antigens were then used in the Luminex test to detect antibodies in the female population of Tunisia. MATERIAL AND METHODS: HPV 16 L1 A modified pGEX vector was constructed for the expression of GST-fusion protein labeled with a C-terminal fusion in E. Supplementary coli. HPV-16 L1 coding sequence lacks N-terminal 10 residues was PCR polymerase chain ends with SmaI SalI / enhanced and inserted into EcoRI digestion pGEX4T3tag open. PCR primers: HPV 16 L1 before 5′GCAGTCCCCGGGGTCTACTTGCCTCCTGTCC HPV 16 L1 reverse 5′GCATGAGTCGACCAGCTTACGTTTTTTGCGTTTAGC E. coli BL21 cells were transformed with plasmids pGEX at room temperature in Luria Bertani medium grown with 1 mM ampicillin; When OD600 of 0 3 recombinant protein expression was induced by adding 0. 25 mM isopropyl-?-D-thio-galactoside (IPTG) in the middle. The bacteria were harvested by centrifugation 15 h after induction. Bacteria pellets were resuspended in 40 mM Tris pH 8, 200 mM NaCl, 1 mM EDTA (ethylenediaminetetraaceticacid) and 2 mM DTT (dithiothreitol) with protease inhibitor cocktail added complete and lysed with a high pressure homogenizer. ATP (adenosine triphosphate) and MgCl2 were at a final concentration of 2 mm and 5 mm or added (Very et al., 2001). HPV 16 E6 and E7 HPV type 16 and 16 E6 E7 coding sequence at its 3 ‘end of a sequence that terminal undecapeptide of SV40 large T antigen (Tag) fused isolated from plasmid pBluescript and inserted into an expression vector pGEX title GST fusion protein in E. coli. These sequences encode E6tag E7tag and were mobilized by digestion and ligated into the digested plasmid downstream of the GST domain. Then, the bacterium E. coli BL 21 cells were cultured with plasmids pGEX and induction of protein expression was induced transformed as described above for L1. The bacteria were harvested 6 h after induction by centrifugation. Bacteria pellets were resuspended in PBS with 2 mM DTT, 1% Triton X-100 and complete protease inhibitor cocktail and lysed by high pressure homogenizer. Lysates were then clarified by centrifugation and aliquots at -20 ° C (very et al., 2002). Titration of protein - To determine the concentrations of various lysates, we used the method of Bradford reagent as described above. was absorbance at 595 nm (Bradford, 1976) is measured. - Separation of recombinant proteins have been made by the migration to 12% polyacrylamide and bands revealed by Coomassie staining. - Titration of antigens: lysates corresponding GST and GST and GST L1tag E6tag E7tag were diluted in 1 / 3 steps, we begin the final concentration of 2 ug / ul and antigen recognition by murine anti-tag has diluted to 1 / 4000, the optical density was determined at 450 nm. Luminex Hardware and software measurements were performed on a system established with the Luminex 100 Total Luminex 100 analyzer, Luminex xyp Plate Handler SD Luminex sheath fluid delivery system, a Pentium 4 personal computer (Dell) Windows 2000 (Microsoft Corp. ) and Luminex is the second Al 2 SP1software (Waterboer et al., 2005). Multiplex serology was detailed by Waterboer et al. , 2005. In short, the method employs beads derivatized with glutathione, thus allowing a pearl-mediated in situ affinity purification of viral antigens, bacterial expressed GST-fusion protein. Spectrally distinct bead sets carrying different viral antigens were washed separately and then mixed. Each serum sample diluted unfiltered mixed in the incubation buffer and beads were combined and incubated. Bound antibodies were biotinylated anti-human secondary antibodies (goat anti-human IgG detected) and the conjugate fluorescence detection (streptavidin-Rphycoerythrin). With the Luminex analyzer reporter beads, and fluorescence was determined in the mean fluorescence intensity (MFI). viral antigens were pGEX vectors in Escherichia coli as GST fusion proteins with dual N-terminal and C-terminal peptide (tag), expressed composed of 11 C-terminal amino acids of large T antigen of simian virus 40th The expression constructs for E6, E7 and L1 of HPV types 16 as GST-fusion proteins has been described (Very et al., 2001, 2002). bacterial lysate was 1 g / L in casein buffer (1 g / L of casein in PBS, pH 7, diluted. 4). For each antigen GC beads with GST-fusion proteins were directly loaded in the lysate and incubated for 1 h at room temperature in the dark on a shaker. The beads are then washed three times with 1 ml of buffer casein. divided human sera from a case-control study in 70 controls and 71 cases of cancer of the cervix. approval of the ethics committee and informed consent of subjects for HPV serology. Sera were at a 1:50 dilution on a shaker for 1 h at room temperature in preincubation buffer preincubated serum-based buffer of casein and 2 g / L of bacterial lysate expression of GST alone antibodies directed against bacterial proteins and residual GST block addressed. Multiplex test: Pearl Sets implementation of different antigens were mixed and mixed 50 mL of each diluted serum preincubated beads were combined and incubated in 96 well plates with soil and filter on a shaker for 1 h at room temperature in the darkness. The beads were washed three times in 100 ul buffer casein on a vacuum chamber. goat biotinylated secondary antibodies [anti-human IgG diluted 1:1000 in casein buffer was added and incubated as before. After washing diluted detection conjugate (streptavidin-R-Phycoerythrin) 1:1000 in casein was incubated with the beads for 30 min. The beads were washed again and the wells were filled with casein buffer. Rapporteur of the fluorescent beads was determined using the Luminex analyzer and as mean fluorescence intensity (MFI). To calculate the specific reactivity of antigen, the MFI was subtracted from the GST-tag of MFI antigen. This method multiplex HPV serology in situ affinity-purified viral antigens, even for a classical ELISA using GST-developed, as described previously (Very et al., 2001). RESULTS: With the aid of the Bradford method, we determined the concentrations of all three protein lysates by measuring the optical density at nm 595th L1tag GST, GST and GST E6tag E7tag following concentrations: 16, 19 and 23. 5 ug / ul or The lysates were compared to bacteria expressing GST L1tag (lane 3), GST E6tag (lane 5), GST E7tag (lane 4), GST-Tag (lane 2). The proteins were separated by gel electrophoresis and Coomassie. M. molecular weight marker in kDa molecular mass on the left (lane 1) bulbs. As the chart illustrates, the different bands obtained by the different recombinant proteins show different apparent molecular weights. GST L1tag revealed by migration in gel electrophoresis a molecular weight of 82 kDa and 40-45 kDa for HPV-16 E6 and E7 or GST-fusion proteins. However GSTtag showed a band of about 31 kDa. To determine the limit of detection of these proteins were added at different dilutions were performed. As shown in Figure 2 and with lower concentrations, has been the best proof of GST alone, followed by E6 and E7 L1 antigens were obtained. The data showed higher percentages of HIV infection in cases of cancer of the cervix uteri compared to controls on the three antigens L1, E6 and E7 analyzed by Luminex assay: 21%, 44% and 61%; differences in results between cases and controls were significant (P In addition, technology allows us to Luminex tested to determine the intensity of the immune response by analyzing the MFI values for different groups of patients for the three specific antigens. The data showed that among cases of cancer of the cervix, the distribution values of MFI is different and it depends on the type of antigen and high intensity of fluorescence was observed for antigens E6 and E7 beginning from the end of the L1 antigen. In fact, the values do not exceed 5609 units of L1, while reaching for the E6 and E7, values higher than 13 MFI 317 and 13 235 were identified antigens E6 and E7 or DISCUSSION: In this study, we have three recombinant proteins for HPV-16 GST products L1tag, GST and GST in E. E6tag E7tag coli. After production, we checked the size of the protein separation by gel electrophoresis and the results are in line with the literature (Very et al., 2001, 2002). Previous studies have shown that different systems for the production of viral expression of HPV s. 16 (Biemelt and can be used., 2003). Indeed, virus-like particles (VLPs) expressed in different systems: mammalian cells, yeast, baculovirus, transgenic plants, Semliki Forest virus, Salmonella and E. coli (Sasagawa et al. 1995; Hagensee et al. 1993; lyengar et al. 1996; Kirnbauer et al. 1993; Neep et al., 1996). Among these different systems that can be used, the literature has reported that the yeast were large quantities of recombinant protein in its native conformation to produce, and the potential for contamination by toxins or infectious virus is minimal compared to bacteria or mammalian cell expression systems. In addition, yeast is a suitable host for the production of heterologous eukaryotic proteins, because it allows post-translational processing of polypeptides, such as wrinkles and phosphorylation. In fact, previous studies have expressed HPV16 E7 pombe proteins in Schizosaccharomyces and they have a clean record (Braspenning et al., 1997). Gr pombe yeast system has several advantages (Yuko et al., 1999). In fact, it can be easily manipulated, low cost synthetic medium is used, and a few milligrams of recombinant proteins can be produced. Braspenning et al. Have 1997 Protocol for the purification of human papillomavirus HPV 16 E7 protein expressed in yeast Sz developed. pombe by chromatography. In previous work, the authors have expressed recombinant proteins E6tag E7tag and for HPV 16 and 18 in Gr Pombe (Meschede et al., 1998). The purified recombinant proteins were separated by silver stained sodium dodecyl sulfate polyacrylamide gels. Antigen production in plants is known to be safe and potentially very cost effective alternative to traditional systems of expression. HPV 16 L1 capsid major in Nicotiana tabacum cv proteinhave expressed. Xanthi plants producing prophylactic vaccines. This system is often not easy to practice (Varsan et al., 2003). In comparison to other uses system I / coli in our work, has the advantage of easy production and purification of the antigen and supplies large quantities of proteins that can be used for a variety of studies, including including the antigen and production of vaccines, immunology and molecular studies of structural and biochemical properties of biological cells. Although many strains of E. coli host used for cloning and expression vectors pGEX with, however, some strains such as E. coli strain BL 21 to maximize the expression of fusion proteins of long duration. This strain is defective in production of T-OMP and Lon protease and is the only tribe to the site, the fusion protein in a soluble form of expressing intact. In addition, glutathione S-transferase (GST) gene fusion system is an integrated system for the expression, purification and detection of fusion proteins glutathione S-transferase E. coli (Hi and Bell, 1998). Recently, researchers have mediated transient expression of a vector of potato virus X-derived E7 protein targeted for secretion system benthamiana (Franconi et al., 2006). In addition, the production of recombinant proteins L1, E6 and E7, how, and their stability has been verified. higher detection rate obtained for the GST, introduced at the same concentration, detection of E6 and E7 than L1. The differences in production and the ability to recognize the mouse anti-tag recombinant proteins from different L1tag GST, GST and GST E6tag E7tag may, by the fact that the L1 protein of relatively high molecular weight, that being said, why it takes several steps of purification for the release of bacterial proteins that can grow with the recombinant proteins (Waterboer et al., 2005). These protein antigens prepared with concentrations of 16, 19 and 23 years. 5 ug / ul for L1, E6 and E7, or have in Luminex test was used for the detection of antibodies in human serum Tunisian female. The multiplex antibody analysis system allows a large number of sera directed against different antigens in parallel and has the potential to replace ELISA technology. Therefore, this method allows simultaneous analysis of large numbers of sera for antibodies against several viral antigens would be useful for sero-epidemiological study of prevalence and disease association of human papillomavirus (HPV). The literature has reported that HPV type-specific. The fight against the most important protein L1 capsid protein are markers of infection and those for the viral oncoproteins E6 and E7 are markers for HPV-associated cancer (Dillner, 2005; Waterboer et al., 2005). Data from this study showed that the intensity of the immune response important for early antigens E6 and E7 from the L1 antigen, which can be explained by differences in the properties of these proteins. The antibody response against HPV is usually a particular type and HPV serology is an important technology for determining the spread of infection by HPV type-specific population and monitoring the impact induce vaccines against HPV antibodies in protective. The literature has shown that antibodies against the HPV major capsid protein, L1, are induced after infection and usually remain detectable for years after clearance of infection, because the class of antibodies between Exposure to infectious brand belong. The concentration of these antibodies correlated well with protection, and it is for the L1 antibody, there is an urgent need for effective, standardized methods for HPV serological implementation of immunization efforts and evaluation epidemiological surveillance of the spread of HPV type-specific infection (Dillner, 2005). In this work, the Luminex improved the sensitivity of the antibody response and can conventional serological methods such as ELISA, which allows the analysis of serum antibodies to replace a single antigen per well. However, this method for HPV serology analysis multiplex fluorescent bead links in the table provides a generic method of in situ affinity purification of glutathione S-transferase (GST)-fusion protein developed for conventional ELISA. High density planar arrays enable the analysis of the large number of targets, but in the number of samples can be analyzed within reasonable limits of acceptable cost. In conclusion, allowed the production of recombinant proteins in E. coli for us, recombinant proteins of HPV types, as well as many other proteins relatively easily in large quantities. Increased sensitivity and low uncertainty of the method based on Luminex and the possibility for the simple combination of different antibody tests lead to a renewed interest in using predictive value of these antibodies in oncology. In addition, using the Luminex technology, and in countries without screening program for cervical cancer within our country we are able to examine the feasibility of the serological analysis of sero-epidemiological or for implementation of vaccination in the Tunisian population of women by parallel testing for antibodies to investigate against three antigens (E6, E7 and L1 of HPV type 16). Acknowledgements: We would like Dr. Pawlita M and P Very thank Dr. and Dr. Waterboer. T DKFZ Heidelberg, Germany) for providing me all the necessary products and materials for the Luminex software. References: Biemelt S, Sonnewald U, P Galmbacher, Willmitzer L, Muller M (2003). Production of human papillomavirus type 16 virus-like particles in transgenic plants. J. Virol. 77: 9211-9220. Bradford MM (1976). A rapid and sensitive method for quantifying the amounts of protein using the principle of protein-dye binding. Ana. Biochem. 72: 248-254. Braspenning J, Manetti R, Zumbach K, Meschede W, L Gissman, Tommasino M (1997). A general purification protocol for E7 protein of high-and low-risk “types of human papilloma virus, expressed in the yeast Schizosaccharomyces pombe. Purification Prot Expr. 10: 192-201. Castle PE, Giuliano AR (2003). genital tract infections, cervical inflammation and antioxidant nutrients – assessing their roles as human papillomavirus cofactors. J. Natl. Cancer. Inst Monogr. 31: 29-34. Dillner J, Brown DR (2004). Can genital HPV infection tract and cervical cancer be prevented with a vaccine? Expert. Mol Med Rev 9: 1-21. Dillner J (2005). Cons “Serolomics”: Papillomavirus Serology takes a lead in broadband Technologic Multiplexed Antibody Analysis. Clinic. Chemistry. 51: 1768-1769. Dillner J, M Arbyn, Dillner L (2007). Translational Mini-Review Series on Vaccines: Monitoring of vaccination against human papillomavirus. Clin. Exp Immunol. 148: 199-207. Franconi R, Massa S, Illiano E, A Mullar, Cirilli A, Accardi L, Di Bonito P, Giorgi C, Venuti A (2006). Operation of the plant secretory pathway of the anti-cancer effect of a plant to improve the vaccine HPV 16 E7 derived. Int. J. Immunopathol. Pharmacol. 19: 187-197. Hagensee Mr E, Yaegashi N Dan Galloway (1993). Self-assembly of human papillomavirus type 1 capsids by expression of the L1 protein alone or co-expression of capsid proteins L1 and L2. J. Virol. 67: 315-322. S Iyengar, KV Shah, KL Kotloff, SJ Ghim, viscida RP (1996). Self-assembly in vitro translation of human papillomavirus type 16 L1 capsid protein virus-like particles and antigenic reactivity of the protein. Clin. Diagn. Laboratory. Immunol. 3: 733-739. Kirnbauer R, Taub J, Greenstone H, Roden R, Durst M et al, Lowy DR, Schiller JT (1993). Efficient self-assembly of human papillomavirus type 16 L1 and L1-L2 into virus-like particles. J. Virol, 67: 6929-6936. Meschede W, Zumbach K, Braspenning J, Scheffner M, LB Bribiesca, J Luanda Gissman L, Pawlita M (1998). Antibodies against early proteins of human papillomaviruses as diagnostic markers for invasive cervical cancer. J. Clin. Microbiol. 36:475-80. Mr Neep P, Hofmann KJ, Jansen KU (1996). Expression of major capsid protein of human papillomavirus type 11 in Saccharomyces cerevisiae cerevisiae. Gene. 18: 1-6. Hi M, Bell PA (1998). Troubleshooting expression of GST fusion protein in E. coli. News Life Science, Amersham. Life Sciences: 1-3. Sasagawa T, P Pushko, G Steers, Gschmeissner SE Hajibagheri MA, Finch J, Crawford L, Tommasino M (1995). Synthesis and assembly of viral particles from human papillomavirus type 6 and type 16 in fission yeast Schizosaccharomyces pombe. Virology. 206:126-135. Very P, Zumbach K, Pawlita M (2001). A generic capture ELISA for recombinant proteins fused to glutathione S-transferase: validation for HPV serology. J. Immunol. Methods. 253: 153-162. Most P, Muller M, Höpfl R, M Pawlita Widschwendter A (2002). detection of antibodies against HPV by ELISA with capsid protein L1 fused to glutathione S-transferase. J. Virol. Methods. 106: 61-70. JG Sue, JK Jane, Katie K, Jeremy DG, Joshua S, O’Shea KH Meredith F. Xavier B, Silvia Sanjos’ec Eduardo LF (2007). Cost-effectiveness of HPV 16, 18 vaccination in Brazil. Vaccines. 25: 6257-6270. Varsan A, Al Williamson, Rose RC, Jaffer M, Ribicki EP (2003). Expression of human papillomavirus type 16 major capsid protein in transgenic Nicotiana tabacum cv. Xanthi. Arch Virol. 148: 1771-1786. Waterboer T, Sehr P, Pawlita M (2006). Remove non-specific binding in serological Luminex. J. Immunol. Methods. 309: 200-204. Waterboer T, Sehr P, Michael KM, Franceschi S, Nieland JD, Joos TO, Templin MF, Pawlita M (2005). Multiplex human papillomavirus serology based on in-situ protein glutathione-S-transferase purified fusion. Clin. Chem 51: 1845-1853. Yuko GH, Hiromichi K (1999). expression system of foreign genes using the yeast Schizosaccharomyces pombe. Biotechnol. Appl. Biochem. 30: 235-244.

Corresponding author:
Achour Mongia

Leave a Comment

Previous post:

Next post: